Transposon trimming results: This is cutadapt 3.5 with Python 3.9.6 Command line parameters: -a ACAGGTTGGATGATAAGTCCCCGGTCTTCGTAATCTCGTATGCCGTCTTCTGCTTG --no-indels --discard-untrimmed -m 7 -o Day14_trimmed.fastq Day14.fastq Processing reads on 1 core in single-end mode ... Finished in 14.04 s (15 µs/read; 3.92 M reads/minute). === Summary === Total reads processed: 918,587 Reads with adapters: 791,693 (86.2%) == Read fate breakdown == Reads that were too short: 9,380 (1.0%) Reads discarded as untrimmed: 126,894 (13.8%) Reads written (passing filters): 782,313 (85.2%) Total basepairs processed: 43,071,119 bp Total written (filtered): 12,257,062 bp (28.5%) === Adapter 1 === Sequence: ACAGGTTGGATGATAAGTCCCCGGTCTTCGTAATCTCGTATGCCGTCTTCTGCTTG; Type: regular 3'; Length: 56; Trimmed: 791693 times Minimum overlap: 3 No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Bases preceding removed adapters: A: 98.0% C: 1.6% G: 0.1% T: 0.3% none/other: 0.0% WARNING: The adapter is preceded by 'A' extremely often. The provided adapter sequence could be incomplete at its 5' end. Ignore this warning when trimming primers. Overview of removed sequences length count expect max.err error counts 3 416 14352.9 0 416 4 6 3588.2 0 6 5 56 897.1 0 56 6 88 224.3 0 88 7 69 56.1 0 69 8 90 14.0 0 90 9 126 3.5 0 126 10 6 0.9 1 1 5 11 50 0.2 1 40 10 12 181 0.1 1 143 38 13 3 0.0 1 0 3 14 259 0.0 1 193 66 15 252 0.0 1 169 83 17 1 0.0 1 0 1 18 97 0.0 1 70 27 19 23 0.0 1 19 4 20 25 0.0 2 17 4 4 21 32 0.0 2 17 9 6 22 45 0.0 2 26 12 7 23 81 0.0 2 53 21 7 24 48 0.0 2 29 15 4 25 40 0.0 2 24 5 11 26 19 0.0 2 13 4 2 27 37 0.0 2 21 9 7 28 9440 0.0 2 2502 3666 3272 29 680 0.0 2 221 209 250 30 262611 0.0 3 140928 69404 34153 18126 31 432601 0.0 3 223975 115457 61491 31678 32 795 0.0 3 298 225 171 101 33 166 0.0 3 54 59 30 23 34 1118 0.0 3 524 293 180 121 35 1105 0.0 3 527 284 182 112 36 2528 0.0 3 784 695 599 450 37 6694 0.0 3 2897 1990 1174 633 38 24977 0.0 3 11030 7042 4286 2619 39 37329 0.0 3 16468 10363 6529 3969 40 251 0.0 4 1 52 79 64 55 41 2996 0.0 4 987 764 589 385 271 42 5008 0.0 4 1415 1236 1019 771 567 43 532 0.0 4 185 142 103 62 40 44 366 0.0 4 140 90 67 32 37 45 63 0.0 4 20 13 10 10 10 46 126 0.0 4 38 32 24 17 15 47 257 0.0 4 96 73 38 31 19 WARNING: One or more of your adapter sequences may be incomplete. Please see the detailed output above. This is cutadapt 3.5 with Python 3.9.6 Command line parameters: -a ACAGGTTGGATGATAAGTCCCCGGTCTTCGTAATCTCGTATGCCGTCTTCTGCTTG --no-indels --discard-untrimmed -m 7 -o Day14_trimmed_trimmed.fastq Day14_trimmed.fastq Processing reads on 1 core in single-end mode ... Finished in 5.62 s (7 µs/read; 8.35 M reads/minute). === Summary === Total reads processed: 782,313 Reads with adapters: 91 (0.0%) == Read fate breakdown == Reads that were too short: 7 (0.0%) Reads discarded as untrimmed: 782,222 (100.0%) Reads written (passing filters): 84 (0.0%) Total basepairs processed: 12,257,062 bp Total written (filtered): 1,205 bp (0.0%) === Adapter 1 === Sequence: ACAGGTTGGATGATAAGTCCCCGGTCTTCGTAATCTCGTATGCCGTCTTCTGCTTG; Type: regular 3'; Length: 56; Trimmed: 91 times Minimum overlap: 3 No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Bases preceding removed adapters: A: 42.9% C: 23.1% G: 12.1% T: 22.0% none/other: 0.0% Overview of removed sequences length count expect max.err error counts 3 75 12223.6 0 75 4 2 3055.9 0 2 5 2 764.0 0 2 7 2 47.7 0 2 10 1 0.7 1 0 1 27 1 0.0 2 0 0 1 28 1 0.0 2 0 0 1 33 5 0.0 3 0 0 4 1 34 1 0.0 3 0 1 36 1 0.0 3 0 0 1 This is cutadapt 3.5 with Python 3.9.6 Command line parameters: -a ACAGGTTGGATGATAAGTCCCCGGTCTTCGTAATCTCGTATGCCGTCTTCTGCTTG --no-indels --discard-untrimmed -m 7 -o Day7_trimmed.fastq Day7.fastq Processing reads on 1 core in single-end mode ... Finished in 20.45 s (16 µs/read; 3.74 M reads/minute). === Summary === Total reads processed: 1,275,161 Reads with adapters: 1,104,286 (86.6%) == Read fate breakdown == Reads that were too short: 11,068 (0.9%) Reads discarded as untrimmed: 170,875 (13.4%) Reads written (passing filters): 1,093,218 (85.7%) Total basepairs processed: 59,796,152 bp Total written (filtered): 17,174,595 bp (28.7%) === Adapter 1 === Sequence: ACAGGTTGGATGATAAGTCCCCGGTCTTCGTAATCTCGTATGCCGTCTTCTGCTTG; Type: regular 3'; Length: 56; Trimmed: 1104286 times Minimum overlap: 3 No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Bases preceding removed adapters: A: 98.1% C: 1.5% G: 0.1% T: 0.3% none/other: 0.0% WARNING: The adapter is preceded by 'A' extremely often. The provided adapter sequence could be incomplete at its 5' end. Ignore this warning when trimming primers. Overview of removed sequences length count expect max.err error counts 3 199 19924.4 0 199 4 11 4981.1 0 11 5 151 1245.3 0 151 6 176 311.3 0 176 7 167 77.8 0 167 8 178 19.5 0 178 9 130 4.9 0 130 10 5 1.2 1 0 5 11 54 0.3 1 48 6 12 266 0.1 1 213 53 13 1 0.0 1 0 1 14 405 0.0 1 297 108 15 353 0.0 1 247 106 16 2 0.0 1 1 1 17 3 0.0 1 0 3 18 134 0.0 1 93 41 19 59 0.0 1 37 22 20 35 0.0 2 24 8 3 21 47 0.0 2 25 11 11 22 74 0.0 2 43 16 15 23 113 0.0 2 70 29 14 24 81 0.0 2 40 25 16 25 75 0.0 2 42 23 10 26 75 0.0 2 43 19 13 27 59 0.0 2 32 19 8 28 12110 0.0 2 3335 4786 3989 29 853 0.0 2 268 286 299 30 374700 0.0 3 207765 98502 45455 22978 31 603813 0.0 3 320587 162992 81278 38956 32 890 0.0 3 344 254 172 120 33 159 0.0 3 59 49 33 18 34 1261 0.0 3 575 336 211 139 35 1214 0.0 3 577 333 177 127 36 3194 0.0 3 1045 851 731 567 37 8421 0.0 3 3717 2556 1348 800 38 34018 0.0 3 15017 9705 5799 3497 39 49472 0.0 3 22072 13725 8344 5331 40 295 0.0 4 2 68 76 80 69 41 3757 0.0 4 1166 1032 739 504 316 42 5568 0.0 4 1535 1410 1114 853 656 43 645 0.0 4 226 164 108 86 61 44 561 0.0 4 201 138 104 65 53 45 54 0.0 4 21 11 10 8 4 46 140 0.0 4 41 36 25 20 18 47 308 0.0 4 133 79 46 32 18 WARNING: One or more of your adapter sequences may be incomplete. Please see the detailed output above. This is cutadapt 3.5 with Python 3.9.6 Command line parameters: -a ACAGGTTGGATGATAAGTCCCCGGTCTTCGTAATCTCGTATGCCGTCTTCTGCTTG --no-indels --discard-untrimmed -m 7 -o Day7_trimmed_trimmed.fastq Day7_trimmed.fastq Processing reads on 1 core in single-end mode ... Finished in 8.06 s (7 µs/read; 8.14 M reads/minute). === Summary === Total reads processed: 1,093,218 Reads with adapters: 149 (0.0%) == Read fate breakdown == Reads that were too short: 17 (0.0%) Reads discarded as untrimmed: 1,093,069 (100.0%) Reads written (passing filters): 132 (0.0%) Total basepairs processed: 17,174,595 bp Total written (filtered): 2,078 bp (0.0%) === Adapter 1 === Sequence: ACAGGTTGGATGATAAGTCCCCGGTCTTCGTAATCTCGTATGCCGTCTTCTGCTTG; Type: regular 3'; Length: 56; Trimmed: 149 times Minimum overlap: 3 No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Bases preceding removed adapters: A: 41.6% C: 18.1% G: 12.8% T: 27.5% none/other: 0.0% Overview of removed sequences length count expect max.err error counts 3 124 17081.5 0 124 4 1 4270.4 0 1 5 4 1067.6 0 4 7 3 66.7 0 3 14 1 0.0 1 0 1 15 3 0.0 1 2 1 19 1 0.0 1 0 1 27 4 0.0 2 0 0 4 31 2 0.0 3 0 0 1 1 33 5 0.0 3 0 0 2 3 36 1 0.0 3 0 0 1 This is cutadapt 3.5 with Python 3.9.6 Command line parameters: -a ACAGGTTGGATGATAAGTCCCCGGTCTTCGTAATCTCGTATGCCGTCTTCTGCTTG --no-indels --discard-untrimmed -m 7 -o Input_trimmed.fastq Input.fastq Processing reads on 1 core in single-end mode ... Finished in 4.79 s (15 µs/read; 3.98 M reads/minute). === Summary === Total reads processed: 317,857 Reads with adapters: 210,757 (66.3%) == Read fate breakdown == Reads that were too short: 2,794 (0.9%) Reads discarded as untrimmed: 107,100 (33.7%) Reads written (passing filters): 207,963 (65.4%) Total basepairs processed: 14,872,168 bp Total written (filtered): 3,281,936 bp (22.1%) === Adapter 1 === Sequence: ACAGGTTGGATGATAAGTCCCCGGTCTTCGTAATCTCGTATGCCGTCTTCTGCTTG; Type: regular 3'; Length: 56; Trimmed: 210757 times Minimum overlap: 3 No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Bases preceding removed adapters: A: 97.0% C: 2.4% G: 0.2% T: 0.4% none/other: 0.0% WARNING: The adapter is preceded by 'A' extremely often. The provided adapter sequence could be incomplete at its 5' end. Ignore this warning when trimming primers. Overview of removed sequences length count expect max.err error counts 3 340 4966.5 0 340 4 13 1241.6 0 13 5 37 310.4 0 37 6 40 77.6 0 40 7 26 19.4 0 26 8 45 4.9 0 45 9 36 1.2 0 36 10 4 0.3 1 3 1 11 11 0.1 1 8 3 12 132 0.0 1 100 32 13 1 0.0 1 0 1 14 144 0.0 1 100 44 15 138 0.0 1 97 41 16 3 0.0 1 3 17 3 0.0 1 0 3 18 69 0.0 1 44 25 19 18 0.0 1 13 5 20 15 0.0 2 8 3 4 21 14 0.0 2 4 7 3 22 16 0.0 2 9 4 3 23 29 0.0 2 15 11 3 24 10 0.0 2 6 1 3 25 10 0.0 2 5 2 3 26 9 0.0 2 7 2 27 17 0.0 2 7 7 3 28 2944 0.0 2 601 1061 1282 29 265 0.0 2 61 88 116 30 63733 0.0 3 28003 17027 11191 7512 31 122504 0.0 3 53027 33028 21967 14482 32 284 0.0 3 83 83 63 55 33 86 0.0 3 23 28 22 13 34 307 0.0 3 123 77 54 53 35 256 0.0 3 106 73 39 38 36 664 0.0 3 161 187 172 144 37 1547 0.0 3 509 496 329 213 38 4548 0.0 3 1720 1262 917 649 39 9563 0.0 3 3545 2696 1956 1366 40 107 0.0 4 0 27 32 25 23 41 926 0.0 4 250 218 227 132 99 42 1526 0.0 4 374 360 315 267 210 43 100 0.0 4 29 24 18 19 10 44 56 0.0 4 22 9 11 8 6 45 12 0.0 4 2 1 4 3 2 46 54 0.0 4 17 20 8 6 3 47 95 0.0 4 29 30 17 15 4 WARNING: One or more of your adapter sequences may be incomplete. Please see the detailed output above. This is cutadapt 3.5 with Python 3.9.6 Command line parameters: -a ACAGGTTGGATGATAAGTCCCCGGTCTTCGTAATCTCGTATGCCGTCTTCTGCTTG --no-indels --discard-untrimmed -m 7 -o Input_trimmed_trimmed.fastq Input_trimmed.fastq Processing reads on 1 core in single-end mode ... Finished in 1.64 s (8 µs/read; 7.59 M reads/minute). === Summary === Total reads processed: 207,963 Reads with adapters: 58 (0.0%) == Read fate breakdown == Reads that were too short: 2 (0.0%) Reads discarded as untrimmed: 207,905 (100.0%) Reads written (passing filters): 56 (0.0%) Total basepairs processed: 3,281,936 bp Total written (filtered): 1,165 bp (0.0%) === Adapter 1 === Sequence: ACAGGTTGGATGATAAGTCCCCGGTCTTCGTAATCTCGTATGCCGTCTTCTGCTTG; Type: regular 3'; Length: 56; Trimmed: 58 times Minimum overlap: 3 No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Bases preceding removed adapters: A: 37.9% C: 8.6% G: 22.4% T: 31.0% none/other: 0.0% Overview of removed sequences length count expect max.err error counts 3 50 3249.4 0 50 5 1 203.1 0 1 6 1 50.8 0 1 7 3 12.7 0 3 27 1 0.0 2 0 0 1 33 2 0.0 3 0 0 1 1